GENOME101.com 

News, * Jobs *, Resources

Research, Information, BioTech  

 

  Exact Time

 

 
Custom Search

 

 
  

 

Custom Search

 

GENOME101 GURU Custom Search on Anything! - Try it now!
  Get a job today!  1000s of Jobs!   Click on any job:  
 

Mainframes Jobs

z/OS, DB2, CICS, ECM

COBOL, SysProg, ASM,

Proj Mgrs, QA, Support

Software101 Jobs

JAVA, .NET, C++, C#

HTML, PHP, SQL, Linux

Internet, Web dev

 FIRE101 Jobs

Firemen, Volunteer,

EMT, EMS, Emergency,

Firefighters, Chief

 POLICE101 Jobs

Police Officers, Cops

Law Enforcement,

Paralegal, Forensics

 GENETICS101 Jobs

Lab Techs, Interns,

Genetics Research, Medical

Genetics Counselor, Biotech

 Nursing101 Jobs

Clinical, Emergency, ICU

LPN, RN, Travel, Home

Nurse Practitioners

 

 

 
  

 

 

 

    * Latest "Genome-Software" News * 

 

     Live EBAY Auctions 

 

ILLUMINA HiSeq LABORATORY DNA GENOME SEQUENCER ANALYZER DELL SERVER PC SOFTWARE
$125,000.00
End Date: Monday Jul-30-2018 13:37:05 PDT
Buy It Now for only: $125,000.00
Buy It Now | Add to watch list

Roche 454 GS Junior Sequencer Genome Sequencing Unit No Software
$2,450.00
End Date: Tuesday Aug-14-2018 8:15:48 PDT
Buy It Now for only: $2,450.00
Buy It Now | Add to watch list

Illumina Genome Analyser II w/ PEM IIx Paired End Module, Computer and Software
$3,360.41
End Date: Sunday Jul-22-2018 5:36:20 PDT
Buy It Now for only: $3,360.41
Buy It Now | Add to watch list

UNDERSTANDING THE HUMAN GENOME PROJECT CD ROM (Mac & Windows) High School Ed.
$7.95
End Date: Sunday Jul-22-2018 18:28:32 PDT
Buy It Now for only: $7.95
Buy It Now | Add to watch list

UNDERSTANDING THE HUMAN GENOME PROJECT CD ROM (Mac & Windows) New & Sealed
$12.00
End Date: Sunday Jul-29-2018 11:41:49 PDT
Buy It Now for only: $12.00
Buy It Now | Add to watch list

     Internet Search Results 

  

Enlis Genomics - import with free analysis
Enlis Genomics creates software for the analysis of genome data, exome, and targeted sequencing. Variant analysis. DNA variation. Annotation. NGS analysis.

Quantum Computational Software; Molecular Modeling ...
Q-Chem: Chemistry software, theoretical chemistry and quantum Chemistry software for research, visualization, quantum calculation and molecular modeling

MISA - microsatellite searching tool - IPK Gatersleben
MISA - MIcroSAtellite identification tool This tool allows the identification and localization of perfect microsatellites as well as compound microsatellites which are interrupted by a certain number of bases.

Lists of Genomics Instrument Makers/Consumables Suppliers
This page is devoted to instrument makers, and suppliers of reagents and kits. Let me know if there are other companies that should be listed here.

Green Group - Phrap
Laboratory of PHIL GREEN . CCAGTAATGCACGAGACACAAA +C+++A++GCACG+++CA++++ YCMRYAWKGCACGWSRCASWMR. UW privacy and termsprivacy and terms

Everything Worth Knowing About ... Ancient DNA ...
Everything Worth Knowing About ... Ancient DNA The lure and limitations of a coded past.

Alphabetic File Extension List - FILExt - The File ...
FILExt.com is the file extension source. Here you'll find a collection of file extensions; many linked to the programs that created the files. This is the FILExt home page.

The Decoded Company: Know Your Talent Better Than You Know ...
The Decoded Company: Know Your Talent Better Than You Know Your Customers [Leerom Segal, Aaron Goldstein, Jay Goldman, Rahaf Harfoush] on Amazon.com. *FREE* shipping on qualifying offers.

Guide to Understanding Memory - Practically Networked
Data Formats and Their File Extensions.#24 Printer data file for 24 pin matrix printer (LocoScript) .#ib Printer data file (LocoScript) .#sc Printer data file (LocoScript) .#st Standard mode printer definitions (LocoScript) .$#!

Genome Compiler Corporation
Genome Compiler is an all-in-one free software platform for biologists. You can intuitively visualize & design DNA, import, manage and share your data.

 

 

GENOME101.COM --- Genome Information, News, and Resources, Lots More
Need to Find information on any subject? ASK THE GENOME101 GURU! - Images from Wikipedia

 * Contact us:  support@z101.com
 
                                  

Copyright � 2007-2013  GENOME101.COM